
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-244a23.1
- Ensembl ID:
- ENSDARG00000040004
- ZFIN ID:
- ZDB-GENE-060503-789
- Description:
- fibrocystin-L isoform 1 [Source:RefSeq peptide;Acc:NP_001123871]
- Human Orthologue:
- PKHD1L1
- Human Description:
- polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
- Mouse Orthologue:
- Pkhd1l1
- Mouse Description:
- polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]
Alleles
There are 13 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25091 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7455 | Missense | Mutation detected in F1 DNA | During 2018 |
sa23518 | Nonsense | Available for shipment | Available now |
sa29202 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43278 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14852 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1501 | Nonsense | Available for shipment | Available now |
sa14766 | Nonsense | Available for shipment | Available now |
sa23519 | Nonsense | Available for shipment | Available now |
sa36835 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43279 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23520 | Nonsense | Available for shipment | Available now |
sa10779 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa25091
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 28 | 3895 | 2 | 70 |
ENSDART00000124987 | Nonsense | 54 | 4201 | 3 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23423142)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23352557 GRCz11 19 22936880 - KASP Assay ID:
- 554-7635.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAATGTATCTAATAGACATTTTCTTTTCTTAGGTTTTGCACAAGCCAGC[C/T]AGTTCAATCTCAATGCCAATGACCCAAACCTTGGCAACAAAGTCACACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7455
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Missense | 433 | 3895 | 14 | 70 |
ENSDART00000124987 | Missense | 459 | 4201 | 15 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23432891)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23362306 GRCz11 19 22946629 - KASP Assay ID:
- 554-4186.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AMATTCTCTTYACKTGCTACAGGTACTATATTGAGGTTTTAGTGCACGGA[T/C]ATTCWGGATCAGCATCAGTAGATGTGGGCTTTTTCAAAGAGATCAGCCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23518
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 495 | 3895 | 15 | 70 |
ENSDART00000124987 | Nonsense | 521 | 4201 | 16 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23433211)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23362626 GRCz11 19 22946949 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCATTTTAAAGGATGGAAGCCAACAAGCGCTATCAGAGAGGTTCAGATTT[T/A]GAGAATCAGCAGTGCATGTTTTTCTCTGAACACCTGTGAACTCACATACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29202
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 666 | 3895 | 19 | 70 |
ENSDART00000124987 | Nonsense | 745 | 4201 | 21 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23438557)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23367972 GRCz11 19 22952295 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTAAATACTATACTTATTTAAATTCTAGCTCTGCTTGGCCTACAAAGGG[C/T]AGCTGAGAAATGAACTGGGAATATTGTTCAGTTATGAAACAGCAGATACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43278
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Essential Splice Site | 1783 | 3895 | 35 | 70 |
ENSDART00000124987 | Essential Splice Site | 1979 | 4201 | 39 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23457932)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23387347 GRCz11 19 22971670 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGTCTTTAAGTATGAGCTGCTGCTGACAGGGATAACGCCAAATGAGGG[T/C]AATTAAAAGCACTTCCTTGTTAATATAGATAGGATATGTCATATGTTATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14852
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 2322 | 3895 | 44 | 70 |
ENSDART00000124987 | Nonsense | 2509 | 4201 | 48 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23465296)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23394711 GRCz11 19 22979034 - KASP Assay ID:
- 1641-0483.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGGTGGAGCCTTCTTTATTGAGGATGRCATTGAAACTGGCAACATCCTA[C/T]ARTACAACCTGGCAGTGTTTGTAAAACAGAGCACCAGTTTACAAAATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1501
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 2408 | 3895 | 44 | 70 |
ENSDART00000124987 | Nonsense | 2595 | 4201 | 48 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23465556)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23394971 GRCz11 19 22979294 - KASP Assay ID:
- 554-1426.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGACAGTTCTTCAACAATACAGTGCATTCGCAGGGTTGGTTTGGCTTGTG[G/A]ATTTTCCAAGATTTTTTCCCCATGGAGACCGGCAGCTGCAGCTACTCAAC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa14766
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | None | 3895 | None | 70 | |
ENSDART00000124987 | Nonsense | 2853 | 4201 | 50 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23467103)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23396518 GRCz11 19 22980841 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAGGGTCATCAGTGCTACCGTTCCTTTATAMATTTATGACCCATTCATA[T/A]GGCTGGATGGCAATGCTCCCCACAGGCCAAACATACAACTGGTTATTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23519
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 2953 | 3895 | 52 | 70 |
ENSDART00000124987 | Nonsense | 3244 | 4201 | 58 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23471523)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23400938 GRCz11 19 22985261 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAAATGTGGCTTTACTGACCAGGAACATCCAGATCATTGGTCAGGAGTA[T/A]CCGGATATGTTCACAGAGTCTTATGGAGCTCGAGTTCTGGTGGGAACCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36835
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 2977 | 3895 | 53 | 70 |
ENSDART00000124987 | Nonsense | 3280 | 4201 | 59 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23472077)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23401492 GRCz11 19 22985815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCATAACAGGGAAAGCTCAGATCAGAAATGTTCAGTTCTATCACACTGGA[C/T]AGGAGGGATGGAACGACCTGTCAGACCCACGATACTCTCTGGTGTTTCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43279
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 3334 | 3895 | 62 | 70 |
ENSDART00000124987 | Nonsense | 3640 | 4201 | 68 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23476464)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23405879 GRCz11 19 22990202 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCATTTGTTATCAATTATTGGTTGTCTCGTATCAGCAAGGTGAACCCAT[C/A]GGACTGTGTGGACATGGACTGTGATGCTAAGAAGAAGACTATGTTGAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23520
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 3366 | 3895 | 62 | 70 |
ENSDART00000124987 | Nonsense | 3672 | 4201 | 68 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23476559)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23405974 GRCz11 19 22990297 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAAGACTTGGATGGCAGTTTCCTGGGAGCTGTGGGAGCAGTGGTTCCC[C/T]AGTCGGAGTATGAATGGAATGGAAACCCTCGGCATGGACTGGGTGACTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10779
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050456 | Nonsense | 3477 | 3895 | 64 | 70 |
ENSDART00000124987 | Nonsense | 3783 | 4201 | 70 | 76 |
The following transcripts of ENSDARG00000040004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 23479498)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 23408913 GRCz11 19 22993236 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTACAGGCCCACAAGACYACAGCTGGTGCTCTGGCTACAYATGTCGGAAG[C/T]GAATTTCTCTCTTTCACGCCATTGTTGCCACAAACAAATCCTTTGAYAWC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: