snrnp48

Ensembl ID:
ENSDARG00000039989
ZFIN ID:
ZDB-GENE-030131-4482
Description:
U11/U12 small nuclear ribonucleoprotein 48 kDa protein [Source:RefSeq peptide;Acc:NP_001108614]
Human Orthologue:
SNRNP48
Human Description:
small nuclear ribonucleoprotein 48kDa (U11/U12) [Source:HGNC Symbol;Acc:21368]
Mouse Orthologue:
Snrnp48
Mouse Description:
small nuclear ribonucleoprotein 48 (U11/U12) Gene [Source:MGI Symbol;Acc:MGI:1915047]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25025 Nonsense Mutation detected in F1 DNA During 2018
sa22904 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113834 Nonsense 86 338 2 9
Genomic Location (Zv9):
Chromosome 16 (position 38391331)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37023859
GRCz11 16 36977743
KASP Assay ID:
554-7731.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACAAAGCCGTCTGTTGGCTCACACAGCAGGGATACTCTAAAGAAGAA[C/T]AGGTAAATAAAGGACCATATACTAAATGACTGCAAAATGTATTAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113834 Essential Splice Site 87 338 3 9
Genomic Location (Zv9):
Chromosome 16 (position 38391236)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37023764
GRCz11 16 36977648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATCTTGTAATAAAAATGTGGTGTTTGGTTTGTCCATTTCTTTTTTC[A/T]GGCTGAAATGTATGATCCATCAGCATACTATGAGCAAGCTAACATTACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link