zgc:103479

Ensembl ID:
ENSDARG00000039979
ZFIN ID:
ZDB-GENE-041010-116
Description:
hypothetical protein LOC450002 [Source:RefSeq peptide;Acc:NP_001006023]
Human Orthologue:
TECRL
Human Description:
trans-2,3-enoyl-CoA reductase-like [Source:HGNC Symbol;Acc:27365]
Mouse Orthologue:
Tecrl
Mouse Description:
trans-2,3-enoyl-CoA reductase-like Gene [Source:MGI Symbol;Acc:MGI:2444966]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32866 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015655 Nonsense 18 349 1 13
ENSDART00000135851   None 276 None 10
Genomic Location (Zv9):
Chromosome 2 (position 15145127)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15655954
GRCz11 2 15324544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCGGTTCTGCTCATTTGGACATGCTGGATGAAAGCACTGATTCTTTC[A/T]GAGGCTGGGAGACTTTTGTGTGGCATGGGTTTCACCTGGAGGACTGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link