zgc:101072

Ensembl ID:
ENSDARG00000039974
ZFIN ID:
ZDB-GENE-040718-235
Description:
retinoic acid induced 14-like [Source:RefSeq peptide;Acc:NP_001104687]
Human Orthologue:
RAI14
Human Description:
retinoic acid induced 14 [Source:HGNC Symbol;Acc:14873]
Mouse Orthologue:
Rai14
Mouse Description:
retinoic acid induced 14 Gene [Source:MGI Symbol;Acc:MGI:1922896]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31057 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37278 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058485 Essential Splice Site 56 988 3 18
ENSDART00000058487 Essential Splice Site 56 186 3 7
Genomic Location (Zv9):
Chromosome 21 (position 18398170)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19533659
GRCz11 21 19570295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAAAAGGAGCCTCTCCTACCAAACTTGACAGCGAGGGCAAGTCTGC[G/A]TAAGTATCAGGAACTGAAGCTGTTCTGTTTTCTATTTGATTTGCTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058485 Essential Splice Site 314 988 12 18
ENSDART00000058487   None 186 None 7
Genomic Location (Zv9):
Chromosome 21 (position 18427555)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19563044
GRCz11 21 19599680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCACTTTCCAGCAACAGTGAATCATCCAAAAGATTTAACTACAAGG[T/G]AAAATACTGAAGGAGTGTTGAGAGATGGCAGTATGAAAGTAAAATACATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Left ventricular mass: Genome-wide association study identifies single-nucleotide polymorphism in KCNB1 associated with left ventricular mass in humans: the HyperGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link