
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101072
- Ensembl ID:
- ENSDARG00000039974
- ZFIN ID:
- ZDB-GENE-040718-235
- Description:
- retinoic acid induced 14-like [Source:RefSeq peptide;Acc:NP_001104687]
- Human Orthologue:
- RAI14
- Human Description:
- retinoic acid induced 14 [Source:HGNC Symbol;Acc:14873]
- Mouse Orthologue:
- Rai14
- Mouse Description:
- retinoic acid induced 14 Gene [Source:MGI Symbol;Acc:MGI:1922896]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31057 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa37278 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31057
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058485 | Essential Splice Site | 56 | 988 | 3 | 18 |
ENSDART00000058487 | Essential Splice Site | 56 | 186 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 21 (position 18398170)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 19533659 GRCz11 21 19570295 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAAAAAAAGGAGCCTCTCCTACCAAACTTGACAGCGAGGGCAAGTCTGC[G/A]TAAGTATCAGGAACTGAAGCTGTTCTGTTTTCTATTTGATTTGCTCCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37278
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058485 | Essential Splice Site | 314 | 988 | 12 | 18 |
ENSDART00000058487 | None | 186 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 21 (position 18427555)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 19563044 GRCz11 21 19599680 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTCCACTTTCCAGCAACAGTGAATCATCCAAAAGATTTAACTACAAGG[T/G]AAAATACTGAAGGAGTGTTGAGAGATGGCAGTATGAAAGTAAAATACATA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Left ventricular mass: Genome-wide association study identifies single-nucleotide polymorphism in KCNB1 associated with left ventricular mass in humans: the HyperGEN Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: