akirin1

Ensembl ID:
ENSDARG00000039969
ZFIN ID:
ZDB-GENE-040426-2178
Description:
akirin 1 isoform 2 [Source:RefSeq peptide;Acc:NP_001007187]
Human Orthologue:
AKIRIN1
Human Description:
akirin 1 [Source:HGNC Symbol;Acc:25744]
Mouse Orthologue:
Akirin1
Mouse Description:
akirin 1 Gene [Source:MGI Symbol;Acc:MGI:1915300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42770 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058472   None 189 None 5
ENSDART00000110195 Nonsense 82 211 2 6
Genomic Location (Zv9):
Chromosome 16 (position 35436381)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33168690
GRCz11 16 33122720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGTTGCAGACATGAAGGCACTTGGGATTCTTGGCAACTGTTTACAA[C/T]AAGATGGAAATGTGGTGCAGCAAATAGGTTCAGACTAGTTTAATTCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link