
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbm42
- Ensembl ID:
- ENSDARG00000039910
- ZFIN ID:
- ZDB-GENE-040809-2
- Description:
- RNA-binding protein 42 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRG1]
- Human Orthologue:
- RBM42
- Human Description:
- RNA binding motif protein 42 [Source:HGNC Symbol;Acc:28117]
- Mouse Orthologue:
- Rbm42
- Mouse Description:
- RNA binding motif protein 42 Gene [Source:MGI Symbol;Acc:MGI:1915285]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36247 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22937 | Nonsense | Available for shipment | Available now |
sa10920 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa36247
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058380 | Essential Splice Site | 83 | 402 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 47732066)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 44930262 GRCz11 16 44896978 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAAGAGCTGCAACTTTAGTTGGTCCACCACCCACATTTGTTTGTCCTGG[T/C]AAAACATTTTTCAGTATTTACACTTTTAAACATTCCCATGTGGAAATCGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22937
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058380 | Nonsense | 225 | 402 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 47723581)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 44921777 GRCz11 16 44888493 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGAATGTGCACTTCTTCACAGGAGCAGTTGTCAGCACTGGTGGCAGAA[C/T]AGCAGGCTGCTGTCTTGGCCGCTGGGCTGCTGGAATCCAAGAAGGAAACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10920
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058380 | Nonsense | 336 | 402 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 47719692)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 44917888 GRCz11 16 44884604 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGCAAGAGCRTTCAGCCGGTATCCGTCCTTCCTGAAGGCGAAGGTTGTT[C/T]GAGACAAACGCACTGGGAAAACGAAGGGTTACGGCTTYGTCAGTTTTAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: