zbtb7a

Ensembl ID:
ENSDARG00000039899
ZFIN ID:
ZDB-GENE-050208-583
Description:
Novel protein similar to vertebrate zinc finger and BTB domain containing 7 (ZBTB7) [Source:UniProtK
Human Orthologue:
ZBTB7A
Human Description:
zinc finger and BTB domain containing 7A [Source:HGNC Symbol;Acc:18078]
Mouse Orthologue:
Zbtb7a
Mouse Description:
zinc finger and BTB domain containing 7a Gene [Source:MGI Symbol;Acc:MGI:1335091]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24156 Nonsense Available for shipment Available now
sa24155 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089015 Nonsense 112 617 2 4
ENSDART00000140187 Nonsense 66 571 1 3
Genomic Location (Zv9):
Chromosome 22 (position 20696639)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20351315
GRCz11 22 20376293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTCTGTGTTGGCCTCTTGCAGCACCTACTTCCACAATCTTTTCACCT[C/A]GGGTCCGGCTGCTGACCGTCAGAAAGTCTATGAGCTGGACTTTGTGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089015 Essential Splice Site 182 617 None 4
ENSDART00000140187 Essential Splice Site 136 571 None 3
Genomic Location (Zv9):
Chromosome 22 (position 20696426)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20351102
GRCz11 22 20376080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGACGTCTGCACACACCTGCTGGACACCAAAGTGCTCTCCCCGCCGG[T/C]GGGTAATCAACTTTTTTTTTTTTTTTTTAGCTCAACTGATGCATGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link