
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch1073-329n19.2
- Ensembl ID:
- ENSDARG00000039887
- ZFIN IDs:
- ZDB-GENE-030131-6551, ZDB-GENE-050417-408, ZDB-GENE-100921-12
- Description:
- complement component 1 Q subcomponent-binding protein, mitochondrial [Source:RefSeq peptide;Acc:NP_
- Human Orthologue:
- C1QBP
- Human Description:
- complement component 1, q subcomponent binding protein [Source:HGNC Symbol;Acc:1243]
- Mouse Orthologue:
- C1qbp
- Mouse Description:
- complement component 1, q subcomponent binding protein Gene [Source:MGI Symbol;Acc:MGI:1194505]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31411 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31411
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058346 | Essential Splice Site | 147 | 270 | None | 6 |
ENSDART00000146840 | Essential Splice Site | 164 | 280 | None | 6 |
The following transcripts of ENSDARG00000039887 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 3941202)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 3600480 GRCz11 5 3923933 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGCTGGAGGAAGAGCCCGAGCAGACACAGAAGAGTCAGGAGGAGGAGG[T/C]ATCACTCATACACACGGTTTACACATTACATTACTGTAGAGAAGAGATTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: