arpp19b

Ensembl ID:
ENSDARG00000039880
ZFIN ID:
ZDB-GENE-040426-930
Description:
cAMP-regulated phosphoprotein 19 [Source:RefSeq peptide;Acc:NP_957266]
Human Orthologue:
ARPP19
Human Description:
cAMP-regulated phosphoprotein, 19kDa [Source:HGNC Symbol;Acc:16967]
Mouse Orthologue:
Arpp19
Mouse Description:
cAMP-regulated phosphoprotein 19 Gene [Source:MGI Symbol;Acc:MGI:1891691]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45017 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058336 Nonsense 13 111 1 3

The following transcripts of ENSDARG00000039880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 7926780)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7484060
GRCz10 25 7539304
GRCz11 25 7663396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAATTTGTCGTGATGTCCAGTGAAGTGGAGACCAGCACAGAAGAGCAG[C/T]AGGTTTGCTCATTCAAACACGTTTTGCTTCGAGGGCCGAAACGCATCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link