zgc:100811

Ensembl ID:
ENSDARG00000039872
ZFIN ID:
ZDB-GENE-040801-63
Description:
Mitogen-activated protein-binding protein-interacting protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DEG
Human Orthologue:
ROBLD3
Human Description:
roadblock domain containing 3 [Source:HGNC Symbol;Acc:29796]
Mouse Orthologue:
Robld3
Mouse Description:
roadblock domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1932697]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39128 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058325 Nonsense 34 125 2 4
Genomic Location (Zv9):
Chromosome 16 (position 49713176)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46719170
GRCz11 16 46685886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTATGCTTCAGCTTGTTGAATAACGAAGGCTCTCTCCTGGCGTA[T/A]TCTGGATATGGAGACACAGATGCCAGAGTCACTGCAGCGATCGCCAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link