
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bbs5
- Ensembl ID:
- ENSDARG00000039827
- ZFIN ID:
- ZDB-GENE-040426-1083
- Description:
- Bardet-Biedl syndrome 5 protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWB7]
- Human Orthologues:
- BBS5, RP11-724O16.1
- Human Description:
- Bardet-Biedl syndrome 5 [Source:HGNC Symbol;Acc:970]
- Mouse Orthologue:
- Bbs5
- Mouse Description:
- Bardet-Biedl syndrome 5 (human) Gene [Source:MGI Symbol;Acc:MGI:1919819]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2513 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2513
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058255 | Essential Splice Site | 301 | 342 | 10 | 12 |
The following transcripts of ENSDARG00000039827 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 49274175)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 48589245 GRCz11 9 48286640 - KASP Assay ID:
- 554-3187.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCCTGATGACGTGGAGATTGAGCCGGATGAGCACACGGATGCTTTTACTG[T/A]GARTTTTACCTCATGTGCTACTCTYAGAAATAATGACGCTCTGCTTTCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: