
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dync2li1
- Ensembl ID:
- ENSDARG00000039770
- ZFIN ID:
- ZDB-GENE-040426-1230
- Description:
- Cytoplasmic dynein 2 light intermediate chain 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXY4]
- Human Orthologue:
- DYNC2LI1
- Human Description:
- dynein, cytoplasmic 2, light intermediate chain 1 [Source:HGNC Symbol;Acc:24595]
- Mouse Orthologue:
- Dync2li1
- Mouse Description:
- dynein cytoplasmic 2 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:1913996]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22241 | Nonsense | Available for shipment | Available now |
sa35430 | Nonsense | Available for shipment | Available now |
sa31909 | Essential Splice Site | Available for shipment | Available now |
sa6287 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42151 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22241
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058147 | Nonsense | 141 | 358 | 6 | 13 |
- Genomic Location (Zv9):
- Chromosome 13 (position 10538941)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 10841270 GRCz11 13 10973745 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTCTAAACCCAATGCGCTCTGGGAGACCATGGAAAGTCTGCTAGGAT[C/A]AGCTCGAAATCAGGTGGAAAAAGTGTGTGCCGCGCTGCAGAAGACAGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35430
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058147 | Nonsense | 168 | 358 | 6 | 13 |
- Genomic Location (Zv9):
- Chromosome 13 (position 10539021)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 10841350 GRCz11 13 10973825 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGCGCTGCAGAAGACAGGAGAATCCAGATCTGGCAAACAACGAGTCCCA[C/T]GAGTCCTCCACAAGGACTATCCGGTACAGAGGATTACACCATTTCTTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31909
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058147 | Essential Splice Site | 198 | 358 | 7 | 13 |
- Genomic Location (Zv9):
- Chromosome 13 (position 10539194)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 10841523 GRCz11 13 10973998 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTCCCTGTTCCTCTGCTCATAGTTGGGAGCAAGTTTGACATTTTTCAG[G/A]TAAAACTTCACTGACATGTTCATAGTAGTATGTACAGTGTGGTGATGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6287
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058147 | Essential Splice Site | 275 | 358 | 10 | 13 |
- Genomic Location (Zv9):
- Chromosome 13 (position 10541639)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 10843968 GRCz11 13 10976443 - KASP Assay ID:
- 554-4771.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTAAACCTCTGGCTAKTCCAGCAGGATCAGACTCYCTRAGTCAAATCGG[T/A]AAGATACGTATKTTTTTGTTAAAGACAAACTAACTTTTATGCTTTTCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42151
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058147 | Essential Splice Site | 308 | 358 | 12 | 13 |
- Genomic Location (Zv9):
- Chromosome 13 (position 10543867)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 10846196 GRCz11 13 10978671 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGACAACCTTATAATAAATGTTCATCTGACCCTCCTATTTATTTTTTC[A/T]GAGCACAAGGGAGCGTAAAGAGCTGAAAGACCCTGTCAAAGACCCTCAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: