zgc:123321

Ensembl ID:
ENSDARG00000039726
ZFIN ID:
ZDB-GENE-051023-1
Description:
protein YIPF7 [Source:RefSeq peptide;Acc:NP_001032310]
Human Orthologue:
YIPF7
Human Description:
Yip1 domain family, member 7 [Source:HGNC Symbol;Acc:26825]
Mouse Orthologue:
Yipf7
Mouse Description:
Yip1 domain family, member 7 Gene [Source:MGI Symbol;Acc:MGI:1922831]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10273 Essential Splice Site Available for shipment Available now
sa22230 Nonsense Available for shipment Available now
sa31908 Essential Splice Site Available for shipment Available now
sa42143 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058064 Essential Splice Site None 247 1 6
ENSDART00000130974   None 247 None 5
Genomic Location (Zv9):
Chromosome 13 (position 8797902)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9100522
GRCz11 13 9432545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAWCAAACCAAGAACCTTCAACTCAAACTCAAGACYGGCGTAGAAAGG[T/A]AAGAGTATAACTTGATTGATGTCRCAGCTGAGATTKTGYACACACTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058064 Nonsense 61 247 3 6
ENSDART00000130974 Nonsense 61 247 2 5
Genomic Location (Zv9):
Chromosome 13 (position 8798280)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9100900
GRCz11 13 9432923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTAGCAGATGAATATGCAGCATCAGCACCTTATACTGGACAAGTGTA[T/G]CAGCCTGTAGCTCAACCCGAGCAAACAGAATATACAGACTCCTATGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058064 Essential Splice Site 134 247 5 6
ENSDART00000130974 Essential Splice Site 134 247 4 5
Genomic Location (Zv9):
Chromosome 13 (position 8798865)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9101485
GRCz11 13 9433508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCCAGAGCACATACCCGTGTGTGTGTGTGTTTATATTTGTTCCGCA[G/A]GCAGGAAAGGCACACTTTGGATATGTATACGGCATCAGTGCTCTGGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058064 Nonsense 238 247 6 6
ENSDART00000130974 Nonsense 238 247 5 5
Genomic Location (Zv9):
Chromosome 13 (position 8801776)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9104396
GRCz11 13 9436419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGAGCGGTCAGCAGCTGCTGGTGGCGTATCCATGTGCTCTTCTGTA[C/A]GGCGTCTTCGCTCTTCTCACTGTCTTCTGAAAATGCTCTGCAAAATCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link