
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000039665
- Ensembl ID:
- ENSDARG00000039665
- Human Orthologues:
- DSG1, DSG2, DSG3, DSG4
- Human Descriptions:
- desmoglein 1 [Source:HGNC Symbol;Acc:3048]
- desmoglein 2 [Source:HGNC Symbol;Acc:3049]
- desmoglein 3 [Source:HGNC Symbol;Acc:3050]
- desmoglein 4 [Source:HGNC Symbol;Acc:21307]
- Mouse Orthologues:
- Dsg1a, Dsg1b, Dsg1c, Dsg2, Dsg3, Dsg4
- Mouse Descriptions:
- desmoglein 1 alpha Gene [Source:MGI Symbol;Acc:MGI:94930]
- desmoglein 1 beta Gene [Source:MGI Symbol;Acc:MGI:2664357]
- desmoglein 1 gamma Gene [Source:MGI Symbol;Acc:MGI:2664358]
- desmoglein 2 Gene [Source:MGI Symbol;Acc:MGI:1196466]
- desmoglein 3 Gene [Source:MGI Symbol;Acc:MGI:99499]
- desmoglein 4 Gene [Source:MGI Symbol;Acc:MGI:2661061]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa3086 | Nonsense | F2 line generated | During 2018 |
sa23638 | Nonsense | Available for shipment | Available now |
sa32274 | Essential Splice Site | Available for shipment | Available now |
sa45688 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa16750 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa3086
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057981 | Nonsense | 130 | 1418 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 7540134)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7374693 GRCz11 20 7364572 - KASP Assay ID:
- 554-3322.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTCCAGGAATAAACGAGCGCCCTGTTGGTTGCTTCATGGTAGAAGAGTAC[A/T]AAGGATTAGTTCGCATCATACAGCCTCTGGATCGTGAAGAGAGGAATAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23638
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057981 | Nonsense | 328 | 1418 | 7 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 7547764)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7382035 GRCz11 20 7371914 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTGAGGATCCAGGCACTGGATATTGATGAAGTACAAACAGACAATTG[G/A]TTGGCTGAGTTCACAATTGTGACAGGGAACGAAGATGGACATTTCAGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32274
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057981 | Essential Splice Site | 360 | 1418 | 7 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 7547862)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7382133 GRCz11 20 7372012 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTAAGACTGATCCAAGGACTAATATGGGGGTTTTGTACCTGAACAAGG[T/C]CAGAGCTTATTTTGTATACAGTTCTGAGAACTGCTGTAATATTTGTGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45688
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057981 | Nonsense | 442 | 1418 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 7548221)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7382492 GRCz11 20 7372371 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGTGGTCAAGCTGGTGCTACTGGAGCTGGTGGTCAGTCTGGATCTTCT[G/T]GAGCCAGCGGTCAATCTGGAGCCTCTGGGGCAGGTTCTCAATTGATGCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16750
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057981 | Nonsense | 695 | 1418 | 11 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 7549853)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7384124 GRCz11 20 7374003 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTGGCCTGCCCCACAGAGCAASTCCTCAATTTAGAGGTTTGCACATGCT[C/A]AGAAGGGGTGGGTTGTGGTTCAAAAATTGSAGAAGTTCATACAAGTTCAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Eosinophilic esophagitis (pediatric): Common variants at 5q22 associate with pediatric eosinophilic esophagitis. (View Study)
- Parkinson's disease (age of onset): Genomewide association study for onset age in Parkinson disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: