si:ch211-221n20.8

Ensembl ID:
ENSDARG00000039652
ZFIN ID:
ZDB-GENE-041014-220
Description:
Novel notch family protein [Source:UniProtKB/TrEMBL;Acc:Q5RJ05]
Human Orthologue:
VWDE
Human Description:
von Willebrand factor D and EGF domains [Source:HGNC Symbol;Acc:21897]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3077 Nonsense F2 line generated During 2018
sa37178 Nonsense Available for shipment Available now
sa37179 Nonsense Mutation detected in F1 DNA During 2018
sa31052 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16574 Essential Splice Site Available for shipment Available now
sa8891 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa3077
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057960 Nonsense 22 737 1 20
ENSDART00000138641   None 373 None 11
Genomic Location (Zv9):
Chromosome 20 (position 52927610)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52780457
GRCz11 20 52586073
KASP Assay ID:
554-3022.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGACTCTGTCAGTGTTTCTCATGCTGTTTGTGGCTCTCGSCGCTCAA[C/T]AAGAAGTYCTCAGATACACAGACACACTGGAAAATACRGGCCAGGTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057960 Nonsense 217 737 6 20
ENSDART00000138641   None 373 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 52938572)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52791419
GRCz11 20 52597035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTCGAGGAGACTGTGAAAACACACTAGGCAGTTACAGGTGTGTGTGT[C/T]AGCGTGGTTACCGTGGCAATGGCACACACTGCACAGGTGAGTAACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057960 Nonsense 300 737 8 20
ENSDART00000138641 Nonsense 31 373 1 11
Genomic Location (Zv9):
Chromosome 20 (position 53051927)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52904774
GRCz11 20 52710390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCACAAACCAGCCGGGGTCCTACAGCTGTCAGTGCAGCGCCGGATA[C/A]ACCATCACTGCAGATCTGCACAACTGCACAGGTAAAGGAGCGAGAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057960 Essential Splice Site 435 737 11 20
ENSDART00000138641 Essential Splice Site 166 373 4 11
Genomic Location (Zv9):
Chromosome 20 (position 53053703)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52906550
GRCz11 20 52712166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCAGAGCAGGATGGGAGCTGAGCGCCGACCAAAGAACATGCATCGG[T/C]AAAGCACACAAAAGCCATTTGATTGTAGTTTATGATATAAATTAAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057960 Essential Splice Site 540 737 14 20
ENSDART00000138641   None 373 None 11
Genomic Location (Zv9):
Chromosome 20 (position 53059979)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52912826
GRCz11 20 52718442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTCTGTCTGTGTYCTCCAGGGTGGACAGGTGAAGGGTGTCACACAGG[T/C]AGCAACTCWCCACACATCCACATGCACACACTCACTCTYCTGTAYAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057960 Nonsense 542 737 15 20
ENSDART00000138641 Nonsense 270 373 8 11
Genomic Location (Zv9):
Chromosome 20 (position 53060370)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52913217
GRCz11 20 52718833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGRCAATAATRATKGTGTGATATGTGTGTGTGTRTGTGTTAGCGGTGTG[T/A]GAGCTGCCATGTGCAAATGGTGGACGGTGTATTGCTCCAAACACCTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link