
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-221n20.8
- Ensembl ID:
- ENSDARG00000039652
- ZFIN ID:
- ZDB-GENE-041014-220
- Description:
- Novel notch family protein [Source:UniProtKB/TrEMBL;Acc:Q5RJ05]
- Human Orthologue:
- VWDE
- Human Description:
- von Willebrand factor D and EGF domains [Source:HGNC Symbol;Acc:21897]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa3077 | Nonsense | F2 line generated | During 2018 |
sa37178 | Nonsense | Available for shipment | Available now |
sa37179 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31052 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa16574 | Essential Splice Site | Available for shipment | Available now |
sa8891 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa3077
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057960 | Nonsense | 22 | 737 | 1 | 20 |
ENSDART00000138641 | None | 373 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 52927610)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52780457 GRCz11 20 52586073 - KASP Assay ID:
- 554-3022.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTGGACTCTGTCAGTGTTTCTCATGCTGTTTGTGGCTCTCGSCGCTCAA[C/T]AAGAAGTYCTCAGATACACAGACACACTGGAAAATACRGGCCAGGTAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37178
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057960 | Nonsense | 217 | 737 | 6 | 20 |
ENSDART00000138641 | None | 373 | None | 11 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 52938572)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52791419 GRCz11 20 52597035 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGTCGAGGAGACTGTGAAAACACACTAGGCAGTTACAGGTGTGTGTGT[C/T]AGCGTGGTTACCGTGGCAATGGCACACACTGCACAGGTGAGTAACACACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37179
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057960 | Nonsense | 300 | 737 | 8 | 20 |
ENSDART00000138641 | Nonsense | 31 | 373 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 53051927)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52904774 GRCz11 20 52710390 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCTGCACAAACCAGCCGGGGTCCTACAGCTGTCAGTGCAGCGCCGGATA[C/A]ACCATCACTGCAGATCTGCACAACTGCACAGGTAAAGGAGCGAGAACAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31052
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057960 | Essential Splice Site | 435 | 737 | 11 | 20 |
ENSDART00000138641 | Essential Splice Site | 166 | 373 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 53053703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52906550 GRCz11 20 52712166 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTGCAGAGCAGGATGGGAGCTGAGCGCCGACCAAAGAACATGCATCGG[T/C]AAAGCACACAAAAGCCATTTGATTGTAGTTTATGATATAAATTAAAACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16574
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057960 | Essential Splice Site | 540 | 737 | 14 | 20 |
ENSDART00000138641 | None | 373 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 53059979)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52912826 GRCz11 20 52718442 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACGTCTGTCTGTGTYCTCCAGGGTGGACAGGTGAAGGGTGTCACACAGG[T/C]AGCAACTCWCCACACATCCACATGCACACACTCACTCTYCTGTAYAATAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8891
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057960 | Nonsense | 542 | 737 | 15 | 20 |
ENSDART00000138641 | Nonsense | 270 | 373 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 53060370)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52913217 GRCz11 20 52718833 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGRCAATAATRATKGTGTGATATGTGTGTGTGTRTGTGTTAGCGGTGTG[T/A]GAGCTGCCATGTGCAAATGGTGGACGGTGTATTGCTCCAAACACCTGCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: