
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
itm2cb
- Ensembl ID:
- ENSDARG00000039650
- ZFIN ID:
- ZDB-GENE-030131-7806
- Description:
- integral membrane protein 2Cb [Source:RefSeq peptide;Acc:NP_956274]
- Human Orthologue:
- ITM2C
- Human Description:
- integral membrane protein 2C [Source:HGNC Symbol;Acc:6175]
- Mouse Orthologue:
- Itm2c
- Mouse Description:
- integral membrane protein 2C Gene [Source:MGI Symbol;Acc:MGI:1927594]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17500 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17500
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057957 | Essential Splice Site | 142 | 260 | 4 | 6 |
ENSDART00000128103 | Essential Splice Site | 227 | 345 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 2 (position 48405826)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 48437490 GRCz11 2 48291654 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCRATTTTGAGTCGTTATTAACGGAGGTGTTCTGCTTTGTCATCCACAC[A/T]GGGACTCACAGCTTACTACGACATTGCRTTGGATAAGTGCTACGTGATCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: