zgc:103663

Ensembl ID:
ENSDARG00000039647
ZFIN IDs:
ZDB-GENE-041114-57, ZDB-GENE-041114-57
Description:
sodium- and chloride-dependent GABA transporter 1 [Source:RefSeq peptide;Acc:NP_001007363]
Human Orthologue:
SLC6A1
Human Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 [Source:HGNC Symbol;Acc:11042
Mouse Orthologue:
Slc6a1
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27704 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41754 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017551 Essential Splice Site 474 600 11 14
ENSDART00000057952 Essential Splice Site 474 600 12 15
Genomic Location (Zv9):
Chromosome 11 (position 998393)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 984656
GRCz11 11 1011244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTGTTCCTCGTCTTCTTTGAGTGCGTCTCCATATCCTGGTTCTACG[G/T]TAAATGTCCTTAAATAAAATAACTATTTAATTAATTTGAATGCAGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017551 Nonsense 496 600 12 14
ENSDART00000057952 Nonsense 496 600 13 15
Genomic Location (Zv9):
Chromosome 11 (position 995454)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 981717
GRCz11 11 1008305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGGCAACCTGGAGGAGATGATCGGATACAAGCCGTGCATTTGGTGG[A/T]AGCTGTGCTGGGTGGTGTTCACTCCGCTGATCGTGGCGGTAGGTGCATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link