zgc:171759

Ensembl ID:
ENSDARG00000039547
ZFIN ID:
ZDB-GENE-071004-32
Description:
Histone H2B [Source:UniProtKB/TrEMBL;Acc:A7MBY4]
Human Orthologues:
HIST1H2BA, HIST2H2BE
Human Descriptions:
histone cluster 1, H2ba [Source:HGNC Symbol;Acc:18730]
histone cluster 2, H2be [Source:HGNC Symbol;Acc:4760]
Mouse Orthologue:
Hist1h2ba
Mouse Description:
histone cluster 1, H2ba Gene [Source:MGI Symbol;Acc:MGI:2448375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39495 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057788 Nonsense 84 137 1 2
Genomic Location (Zv9):
Chromosome 25 (position 37384010)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35797656
GRCz11 25 36347375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCTTCGAGCGCATCGCCGGTGAGGCTTCACGTCTCGCTCACTACAAC[A/T]AGCGCTCCACCATCACTTCCAGAGAGATCCAGACCGCCGTGCGTCTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link