slit1b

Ensembl ID:
ENSDARG00000039528
ZFIN ID:
ZDB-GENE-030722-4
Description:
slit homolog 1b [Source:RefSeq peptide;Acc:NP_001030147]
Human Orthologue:
SLIT1
Human Description:
slit homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:11085]
Mouse Orthologue:
Slit1
Mouse Description:
slit homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1315203]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24209 Essential Splice Site Available for shipment Available now
sa43879 Nonsense Mutation detected in F1 DNA During 2018
sa37562 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43880 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45778 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37563 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6715 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 132 1102 5 27
ENSDART00000134281   None 640 None 13
Genomic Location (Zv9):
Chromosome 22 (position 37593475)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34910029
GRCz11 22 34885778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTCATAGCAGCTGTATTTTCTTCTGATTTCTTACATGCGTTGCCAT[A/T]GCAGCCAAGGAGCAGTATTACATCCCAGGTAAGTTAATTCAGGCTGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Nonsense 157 1102 6 27
ENSDART00000134281   None 640 None 13
Genomic Location (Zv9):
Chromosome 22 (position 37593651)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34909853
GRCz11 22 34885602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCAGAGGACACACGAATGAATAAGGACTGCAACAGCAAGCCTGTTTG[T/A]CCACCCAAATGCCGCTGTGAAGCTACCGTGGTGGACTGCTCCAATTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 412 1102 11 27
ENSDART00000134281   None 640 None 13
Genomic Location (Zv9):
Chromosome 22 (position 37601347)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34902309
GRCz11 22 34878058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACCTGTCCGCTCTCCCCCGCGGCGTCCCACTCAACGTCACCGAGCTG[T/C]GAGTGTTAACAGGACTCTTGGTGTCTTATCTGCCCTGCATTCAGGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 562 1102 17 27
ENSDART00000134281 Essential Splice Site 104 640 4 13
Genomic Location (Zv9):
Chromosome 22 (position 37611554)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34891723
GRCz11 22 34867472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGCACAATGATAAGATCAAGTCAGAGAGTCAGTGTGTTCTCCCACA[G/T]GTCCAGTGGATGCGTCTGTGTCTGGGAAGTGCAGCCCGTGCTCGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 603 1102 17 27
ENSDART00000134281 Essential Splice Site 145 640 4 13
Genomic Location (Zv9):
Chromosome 22 (position 37611681)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34891596
GRCz11 22 34867345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGACCCCCTTCACCAGTACAAGTGCAGCTGTCCACAGGGATACAAGG[T/C]GTGTTCACTACTGAGGGCACTTGAGAAGAGTACTGGAGAATATCTAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 930 1102 24 27
ENSDART00000134281 Essential Splice Site 472 640 11 13
Genomic Location (Zv9):
Chromosome 22 (position 37627807)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34875470
GRCz11 22 34851219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGACACATCCAGCCGCTCACCAGAGACGCCCCGCTATATGTAGGCGG[T/C]AAGAAGATGATCACAAATAAAACAAATTGACGAGGTCTTTTGACTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 1032 1102 25 27
ENSDART00000134281 Essential Splice Site 574 640 12 13
Genomic Location (Zv9):
Chromosome 22 (position 37630005)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34873272
GRCz11 22 34849021
KASP Assay ID:
554-4462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCCTGCTCACTGCKGCCGCTGCCACAAACCCCTGCCAGAAACACAA[G/A]TGAGTGCCTGTCTGTTCACGACACCCATTTCAGATTAGACAAGGGAATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link