zgc:153119

Ensembl ID:
ENSDARG00000039513
ZFIN ID:
ZDB-GENE-061013-199
Description:
UPF0692 protein C19orf54 homolog [Source:UniProtKB/Swiss-Prot;Acc:B0V3H4]
Human Orthologue:
C19orf54
Human Description:
chromosome 19 open reading frame 54 [Source:HGNC Symbol;Acc:24758]
Mouse Orthologue:
BC024978
Mouse Description:
cDNA sequence BC024978 Gene [Source:MGI Symbol;Acc:MGI:3041247]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14663 Nonsense Available for shipment Available now
sa29064 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057733 Nonsense 51 307 2 7
Genomic Location (Zv9):
Chromosome 18 (position 33752846)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35433688
GRCz11 18 35408534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTTTACCAGGCTTTAGCAGAGGGAAGGACYGCTGTAGAGGGAGACTA[T/A]GAAGAGGCCAGTATTATTATARGACAGAGAGAAAGCAGGTGGACTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057733 Essential Splice Site 172 307 5 7
Genomic Location (Zv9):
Chromosome 18 (position 33756257)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35437099
GRCz11 18 35411945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTGTCATTCTTAAACACCTCATTAACAGGCAGCCCATTCTTATACC[G/T]TATCTTTACTGCTTACATTTGTAATCTCTTATGTAGGTTCACATGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link