zgc:100915

Ensembl ID:
ENSDARG00000039512
ZFIN ID:
ZDB-GENE-040801-159
Description:
hypothetical protein LOC570897 [Source:RefSeq peptide;Acc:NP_001107913]
Human Orthologue:
AP1M2
Human Description:
adaptor-related protein complex 1, mu 2 subunit [Source:HGNC Symbol;Acc:558]
Mouse Orthologue:
Ap1m2
Mouse Description:
adaptor protein complex AP-1, mu 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1336974]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31518 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057732 Essential Splice Site 89 423 3 12
Genomic Location (Zv9):
Chromosome 6 (position 33743816)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34061381
GRCz11 6 34045748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACACCAATGCTGCTCTTGTATACTCCTTCCTGTACAAATTAGTGGAG[G/A]TAAGTGTGTTTTCTATCCATCAACATGACTACACCTTCCATAAAAACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link