si:dkeyp-51c11.1

Ensembl ID:
ENSDARG00000039499
ZFIN ID:
ZDB-GENE-030131-2524
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A5P3]
Human Orthologue:
HEBP2
Human Description:
heme binding protein 2 [Source:HGNC Symbol;Acc:15716]
Mouse Orthologue:
Hebp2
Mouse Description:
heme binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860084]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35497 Essential Splice Site Mutation detected in F1 DNA During 2018
sa142 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057712 Essential Splice Site 45 202 None 6
ENSDART00000132714 Essential Splice Site 51 205 None 4
Genomic Location (Zv9):
Chromosome 13 (position 27264929)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26910589
GRCz11 13 27041039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCATCAAAAGGACTGCCCTGTGTACACTGTGGTAAACCAATATGGGG[T/C]AGGCCTGTGACTTTTTAATATATCTTGAATTTTGTCAACTGTGTGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057712 Nonsense 111 202 5 6
ENSDART00000132714 Nonsense 114 205 3 4
Genomic Location (Zv9):
Chromosome 13 (position 27265982)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26911642
GRCz11 13 27042092
KASP Assay ID:
554-0072.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTATGACCAGGCCTGTGGTGGTCTCAGTAAAGGATGGTGCGGAGGGG[C/T]GACGCGTCTCCATTTCTGTCTTTCAGCAAGACCCCAACATCCCCGATCCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link