zgc:63667

Ensembl ID:
ENSDARG00000039492
ZFIN ID:
ZDB-GENE-040426-1224
Description:
hypothetical protein LOC393451 [Source:RefSeq peptide;Acc:NP_956773]
Human Orthologue:
CYP46A1
Human Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Mouse Orthologue:
Cyp46a1
Mouse Description:
cytochrome P450, family 46, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1341877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29302 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36958 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099258 Essential Splice Site 142 444 6 15
Genomic Location (Zv9):
Chromosome 20 (position 5301871)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5217464
GRCz11 20 5261871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCATGCACGACCTGGTCAACTGTGTTACACTTGATGTCATTTGCAAG[G/A]TTTCTCCATCCTTCTTATTGATCCAAGGGAAAGTCTAATGTGTCAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099258 Nonsense 244 444 9 15
Genomic Location (Zv9):
Chromosome 20 (position 5299581)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5215174
GRCz11 20 5259581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATCTTTTGTTGCAGAGGAAGAAAATGTTAATAACACAGATGATCTT[G/T]AGCAGATGTTGGACAATTTTGTGACTTTCTTTATAGCTGGTGAGTTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link