si:dkey-51a16.9

Ensembl ID:
ENSDARG00000039483
ZFIN ID:
ZDB-GENE-030616-560
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q8AW51]
Human Orthologue:
RNF122
Human Description:
ring finger protein 122 [Source:HGNC Symbol;Acc:21147]
Mouse Orthologue:
Rnf122
Mouse Description:
ring finger protein 122 Gene [Source:MGI Symbol;Acc:MGI:1916117]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28114 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057687 Nonsense 62 155 4 7
ENSDART00000128562 Nonsense 3 82 1 3
ENSDART00000141255 Nonsense 41 134 2 5

The following transcripts of ENSDARG00000039483 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25658826)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25304486
GRCz11 13 25434936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATTGCTATGTGTAACGGAACAATGTCATGTTTTTGTTTCACAGACTC[A/T]GACGACAGGGAACACAAGAACAATATGGATATAATGAGGTAATTTATTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link