zgc:111992

Ensembl ID:
ENSDARG00000039477
ZFIN ID:
ZDB-GENE-050320-30
Description:
Uncharacterized protein C15orf43 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5BJD2]
Human Orthologue:
C15orf43
Human Description:
chromosome 15 open reading frame 43 [Source:HGNC Symbol;Acc:28520]
Mouse Orthologue:
4933406J08Rik
Mouse Description:
RIKEN cDNA 4933406J08 gene Gene [Source:MGI Symbol;Acc:MGI:1921651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34096 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057677 Essential Splice Site 170 212 6 7
Genomic Location (Zv9):
Chromosome 7 (position 32264601)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30658941
GRCz11 7 30930091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTCATGTTGTGAGATGCGGCAATATCCTGTAAACAACATGATCTCAG[G/A]TACTTAATTACCAAATAATGCCATCCATAGTTAACATGTTCTCACTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link