zgc:136953

Ensembl ID:
ENSDARG00000039466
ZFIN ID:
ZDB-GENE-060421-3878
Description:
hypothetical protein LOC678601 [Source:RefSeq peptide;Acc:NP_001035439]
Human Orthologue:
HNRNPH3
Human Description:
heterogeneous nuclear ribonucleoprotein H3 (2H9) [Source:HGNC Symbol;Acc:5043]
Mouse Orthologue:
Hnrnph3
Mouse Description:
heterogeneous nuclear ribonucleoprotein H3 Gene [Source:MGI Symbol;Acc:MGI:1926462]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18456 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057651 Essential Splice Site 81 396 2 9
ENSDART00000113082 Essential Splice Site 81 396 3 10

The following transcripts of ENSDARG00000039466 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23006279)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22735617
GRCz11 13 22866067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGCTTTRGCAAAAGATCGCAAATATATGGGTCATCGTTATATCGAAG[G/A]TATGATCCTGTMTACAGACCAGAAAATGCTGCTTTAATTGYATTTAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link