si:dkey-39n1.2

Ensembl ID:
ENSDARG00000039459
ZFIN ID:
ZDB-GENE-030131-7019
Description:
sulfhydryl oxidase 1 [Source:RefSeq peptide;Acc:NP_001121836]
Human Orthologue:
QSOX1
Human Description:
quiescin Q6 sulfhydryl oxidase 1 [Source:HGNC Symbol;Acc:9756]
Mouse Orthologue:
Qsox1
Mouse Description:
quiescin Q6 sulfhydryl oxidase 1 Gene [Source:MGI Symbol;Acc:MGI:1330818]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34349 Nonsense Mutation detected in F1 DNA During 2018
sa41148 Nonsense Mutation detected in F1 DNA During 2018
sa16020 Nonsense Available for shipment Available now
sa21226 Nonsense Available for shipment Available now
sa7124 Nonsense Mutation detected in F1 DNA During 2018
sa41147 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057645 Nonsense 170 778 4 12
Genomic Location (Zv9):
Chromosome 8 (position 15062214)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14507558
GRCz11 8 14545263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTTCGCCAATACATTATTGAGAATTTGGAGCTACATACCGAGGCTTG[G/A]CCGCCGGCTTGTCCACCTTTAGAGACGGCTAGGTTAGAATGCCATGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057645 Nonsense 204 778 5 12
Genomic Location (Zv9):
Chromosome 8 (position 15061558)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14506902
GRCz11 8 14544607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCTTTCCGGCCAACAATGTGAAGTATCTTGCTCTCGTGTTTGAGAAT[A/T]AAAAGTCTTACGTGGGAAGAGAGGTGAGATCAATTTGCATAATGCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057645 Nonsense 207 778 5 12
Genomic Location (Zv9):
Chromosome 8 (position 15061547)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14506891
GRCz11 8 14544596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAACAATGYSAAGTATCTTGCTCTCGTGTTTGAGAATAAAAAGTCTTA[C/A]GTGGGAAGAGAGGTGAGATCARTTTGCATAATGCTGATTTAGAGAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057645 Nonsense 367 778 9 12
Genomic Location (Zv9):
Chromosome 8 (position 15039745)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14485089
GRCz11 8 14522794
KASP Assay ID:
2260-0290.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGGCCGTCCATCTGTAAAGAGTGCATTACAGGCTGTGGACAGTTGGT[T/A]ACAATCACAGAAGGGGACCGAGATCAAATATAGTGATTTCAGAGACGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057645 Nonsense 411 778 10 12
Genomic Location (Zv9):
Chromosome 8 (position 15036718)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14482062
GRCz11 8 14519767
KASP Assay ID:
554-4766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTGAGGGCGTGCAGTGGGTGGGCTGTCAGGGATCTCAGGCCCGATA[T/A]CGTGGATACCCCTGTGCCGTTTGGACCCTCTTCCATGTGCTTACAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057645 Nonsense 473 778 11 12
Genomic Location (Zv9):
Chromosome 8 (position 15031597)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14476941
GRCz11 8 14514646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCCGTGCGCAACTCACTTTGAGGCTATGGCCGCGGAGAGCATGGAT[C/T]AGGTCAACTCGCTGTCTGGCGCTGTCATTTGGTTGTGGTCACGCCACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link