acbd6

Ensembl ID:
ENSDARG00000039456
ZFIN ID:
ZDB-GENE-030131-2810
Description:
Acyl-CoA-binding domain-containing protein 6 [Source:UniProtKB/Swiss-Prot;Acc:Q4V8X4]
Human Orthologue:
ACBD6
Human Description:
acyl-CoA binding domain containing 6 [Source:HGNC Symbol;Acc:23339]
Mouse Orthologue:
Acbd6
Mouse Description:
acyl-Coenzyme A binding domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1919732]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41146 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057642 Essential Splice Site 210 300 6 8
ENSDART00000110151 Essential Splice Site 210 300 6 9
Genomic Location (Zv9):
Chromosome 8 (position 14922284)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14367628
GRCz11 8 14405333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTTTTTTAAAAACTCTGTTATGATAATAAATGATTTTTGTGTGTGC[A/T]GGGCCGAGCTCTCCTGCACTGGGCGTGTGACAGGGGCCATAAAGACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link