zgc:110353

Ensembl ID:
ENSDARG00000039443
ZFIN ID:
ZDB-GENE-050417-310
Description:
hypothetical protein LOC550482 [Source:RefSeq peptide;Acc:NP_001017785]
Human Orthologues:
ARRDC2, ARRDC3, ARRDC4, TXNIP
Human Descriptions:
arrestin domain containing 2 [Source:HGNC Symbol;Acc:25225]
arrestin domain containing 3 [Source:HGNC Symbol;Acc:29263]
arrestin domain containing 4 [Source:HGNC Symbol;Acc:28087]
thioredoxin interacting protein [Source:HGNC Symbol;Acc:16952]
Mouse Orthologues:
Arrdc2, Arrdc3, Arrdc4, Txnip
Mouse Descriptions:
arrestin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918057]
arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]
arrestin domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913662]
thioredoxin interacting protein Gene [Source:MGI Symbol;Acc:MGI:1889549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16095 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057624 Nonsense 146 319 3 6
Genomic Location (Zv9):
Chromosome 8 (position 25103162)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24228980
GRCz11 8 24250219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTTTCCGTGCTGCRARCAAAGCTGAAGCAAAGTTCACGTTTGTCGCC[A/T]GAGCTGATTACGATCCATCAACAMTGACAGTATGCAGATTATCAGTGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
  • Neuroticism: A genome-wide association study of neuroticism in a population-based sample. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link