snrpb2

Ensembl ID:
ENSDARG00000039424
ZFIN ID:
ZDB-GENE-060616-2
Description:
Snrpb2 protein [Source:UniProtKB/TrEMBL;Acc:Q6PBZ6]
Human Orthologue:
SNRPB2
Human Description:
small nuclear ribonucleoprotein polypeptide B [Source:HGNC Symbol;Acc:11155]
Mouse Orthologue:
Snrpb2
Mouse Description:
U2 small nuclear ribonucleoprotein B Gene [Source:MGI Symbol;Acc:MGI:104805]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38298 Nonsense Mutation detected in F1 DNA During 2018
sa39694 Nonsense Mutation detected in F1 DNA During 2018
sa15176 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057601 Nonsense 26 229 1 6
Genomic Location (Zv9):
Chromosome 1 (position 52203922)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51075606
GRCz11 1 51709970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGACATCCGGCCGAATCACACCATCTACATCAACAATGTTAATGAT[A/T]AGATCAAGAAAGAAGGTAAAGTCTTTCGTTTGTACTGTAACTTGCGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057601 Nonsense 39 229 2 6
Genomic Location (Zv9):
Chromosome 1 (position 52203563)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51075247
GRCz11 1 51709611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTTGTGTTAATCGTTTCTACAGAGCTGAAGAGGTCACTGTACGCCT[T/A]ATTCTCGCAGTTCGGCCAGATTATGGACATCGTGGCTCTGAAGACCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057601 Essential Splice Site 177 229 6 6
Genomic Location (Zv9):
Chromosome 1 (position 52196454)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51068138
GRCz11 1 51702502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWCAAACCAGACATATTTKCTGTTTAYTCATTGGCYTTATTTTATTTTTT[A/T]GGTTTCCTGGGTTTAAAGAAGTGYGTTTGGTGCCTGGAAAACATGATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link