
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-24l11.6
- Ensembl ID:
- ENSDARG00000039378
- ZFIN IDs:
- ZDB-GENE-050419-72, ZDB-GENE-050706-62, ZDB-GENE-050706-62
- Description:
- reticulocalbin-2 [Source:RefSeq peptide;Acc:NP_001025434]
- Human Orthologue:
- RCN2
- Human Description:
- reticulocalbin 2, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:9935]
- Mouse Orthologue:
- Rcn2
- Mouse Description:
- reticulocalbin 2 Gene [Source:MGI Symbol;Acc:MGI:1349765]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2968 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2968
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057548 | Nonsense | 106 | 322 | 4 | 8 |
ENSDART00000147823 | Nonsense | 103 | 319 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 18 (position 26916379)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 26989634 GRCz11 18 26972012 - KASP Assay ID:
- 554-3045.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTTTCTAGAGGAGATCACAGTATGGATACAGAGGGTGTACAGAAAATA[T/A]GCGCTGGACGATGCTGAGGAACGCTTTCCAGAGTTTGACTCCAACAATGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: