si:dkey-24l11.6

Ensembl ID:
ENSDARG00000039378
ZFIN IDs:
ZDB-GENE-050419-72, ZDB-GENE-050706-62, ZDB-GENE-050706-62
Description:
reticulocalbin-2 [Source:RefSeq peptide;Acc:NP_001025434]
Human Orthologue:
RCN2
Human Description:
reticulocalbin 2, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:9935]
Mouse Orthologue:
Rcn2
Mouse Description:
reticulocalbin 2 Gene [Source:MGI Symbol;Acc:MGI:1349765]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2968 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2968
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057548 Nonsense 106 322 4 8
ENSDART00000147823 Nonsense 103 319 3 7
Genomic Location (Zv9):
Chromosome 18 (position 26916379)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26989634
GRCz11 18 26972012
KASP Assay ID:
554-3045.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTCTAGAGGAGATCACAGTATGGATACAGAGGGTGTACAGAAAATA[T/A]GCGCTGGACGATGCTGAGGAACGCTTTCCAGAGTTTGACTCCAACAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link