zgc:110800

Ensembl ID:
ENSDARG00000039374
ZFIN ID:
ZDB-GENE-050327-76
Description:
hypothetical protein LOC541537 [Source:RefSeq peptide;Acc:NP_001014373]
Human Orthologue:
APOOL
Human Description:
apolipoprotein O-like [Source:HGNC Symbol;Acc:24009]
Mouse Orthologue:
Apool
Mouse Description:
apolipoprotein O-like Gene [Source:MGI Symbol;Acc:MGI:1915367]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa722 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057541 Nonsense 3 467 1 9
Genomic Location (Zv9):
Chromosome 5 (position 24651973)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22364845
GRCz11 5 22868645
KASP Assay ID:
554-0630.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCTTTCGCGCTCTGAGATCTTGCTTGACTCCTCTTGCTTTCCGTACT[G/T]AGACTGAAGGGGGCGGGACTGGCATGGCGGCCAAGGTGAGTTTCTCTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link