
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113019
- Ensembl ID:
- ENSDARG00000039364
- ZFIN ID:
- ZDB-GENE-050417-449
- Description:
- spindle and kinetochore associated complex subunit 3 [Source:RefSeq peptide;Acc:NP_001017891]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2589 | Nonsense | F2 line generated | During 2018 |
sa21963 | Nonsense | Available for shipment | Available now |
sa1014 | Nonsense | Available for shipment | Available now |
sa35143 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2589
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057527 | Nonsense | 80 | 507 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 38600613)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7574077 GRCz11 21 7135568 - KASP Assay ID:
- 554-2616.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATAATTAYAAAACTAATTTAAAAANTGTACATTTTAGGCAAACCAGCCTA[T/A]GAAATGCTGGAGTGTGATCCTGATTGGGCTCCATCATTACATCTCGGKCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21963
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057527 | Nonsense | 211 | 507 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 38600222)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7574468 GRCz11 21 7135959 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCGTGCAGAAATTAACCGATTGCTTGAGGAGAACCGCAGACTTAAAAAA[G/T]AGCTCGCTCAGAAGACAATGGATGAGGATTTTTTTAAAGAAGACGACTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1014
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057527 | Nonsense | 258 | 507 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 38600081)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7574609 GRCz11 21 7136100 - KASP Assay ID:
- 554-0918.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATGGGCATTTTGGATCAGATTTTTCCTACTTTGCAGCAAAACAATCGG[A/T]AGCTTTCCCCTTTCCAGATGCTCATCTTAACTCTGATGCGCTTGAAGCTC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa35143
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057527 | Nonsense | 350 | 507 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 38599804)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7574886 GRCz11 21 7136377 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCATGTTGCGTTTATCGTGGATTCCATTGAAATCGACATTGATCGAGTGT[C/A]GAATGGCAAACCTAAAGCACAAATGGTTCCCCAAAACAAGAAGACTTTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: