zgc:113019

Ensembl ID:
ENSDARG00000039364
ZFIN ID:
ZDB-GENE-050417-449
Description:
spindle and kinetochore associated complex subunit 3 [Source:RefSeq peptide;Acc:NP_001017891]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2589 Nonsense F2 line generated During 2018
sa21963 Nonsense Available for shipment Available now
sa1014 Nonsense Available for shipment Available now
sa35143 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2589
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057527 Nonsense 80 507 2 2
Genomic Location (Zv9):
Chromosome 11 (position 38600613)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7574077
GRCz11 21 7135568
KASP Assay ID:
554-2616.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATAATTAYAAAACTAATTTAAAAANTGTACATTTTAGGCAAACCAGCCTA[T/A]GAAATGCTGGAGTGTGATCCTGATTGGGCTCCATCATTACATCTCGGKCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057527 Nonsense 211 507 2 2
Genomic Location (Zv9):
Chromosome 11 (position 38600222)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7574468
GRCz11 21 7135959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGTGCAGAAATTAACCGATTGCTTGAGGAGAACCGCAGACTTAAAAAA[G/T]AGCTCGCTCAGAAGACAATGGATGAGGATTTTTTTAAAGAAGACGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057527 Nonsense 258 507 2 2
Genomic Location (Zv9):
Chromosome 11 (position 38600081)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7574609
GRCz11 21 7136100
KASP Assay ID:
554-0918.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGGCATTTTGGATCAGATTTTTCCTACTTTGCAGCAAAACAATCGG[A/T]AGCTTTCCCCTTTCCAGATGCTCATCTTAACTCTGATGCGCTTGAAGCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057527 Nonsense 350 507 2 2
Genomic Location (Zv9):
Chromosome 11 (position 38599804)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7574886
GRCz11 21 7136377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTTGCGTTTATCGTGGATTCCATTGAAATCGACATTGATCGAGTGT[C/A]GAATGGCAAACCTAAAGCACAAATGGTTCCCCAAAACAAGAAGACTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link