zgc:92321

Ensembl ID:
ENSDARG00000039354
ZFIN ID:
ZDB-GENE-040718-334
Description:
Spindle and kinetochore-associated protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHG8]
Human Orthologue:
SKA1
Human Description:
spindle and kinetochore associated complex subunit 1 [Source:HGNC Symbol;Acc:28109]
Mouse Orthologue:
Ska1
Mouse Description:
spindle and kinetochore associated complex subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1913718]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41627 Nonsense Mutation detected in F1 DNA During 2018
sa38790 Nonsense Mutation detected in F1 DNA During 2018
sa16478 Essential Splice Site Available for shipment Available now
sa41626 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057513 Nonsense 161 258 5 6
ENSDART00000145077 Nonsense 161 258 6 7
Genomic Location (Zv9):
Chromosome 10 (position 17574623)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17586969
GRCz11 10 17544403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCCTCACTTGTTTCTGTCACAGGTACATGAAAGGGCGCGTAACATA[C/A]GATCAGCTGAACGCAGCAGTACAAAGCATCAACACAGCCGTGACCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057513 Nonsense 179 258 5 6
ENSDART00000145077 Nonsense 179 258 6 7
Genomic Location (Zv9):
Chromosome 10 (position 17574569)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17586915
GRCz11 10 17544349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGAACGCAGCAGTACAAAGCATCAACACAGCCGTGACCTCAAAATA[T/G]AAAATCCTCCATCAGCCAGTCAAGACCCTAAACAACGTGTCTCGCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057513 Essential Splice Site 210 258 5 6
ENSDART00000145077 Essential Splice Site 210 258 6 7
Genomic Location (Zv9):
Chromosome 10 (position 17574476)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17586822
GRCz11 10 17544256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCGCTCCAGCARCGCTTTAAAGATCAAGAAACAAAAGACACCAAAGG[T/G]ATCACAGTTTTAWCTGTCTGTCTGTTGCGGAGACGCTGATCAAAGGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057513 Nonsense 238 258 6 6
ENSDART00000145077 Nonsense 238 258 7 7
Genomic Location (Zv9):
Chromosome 10 (position 17574125)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17586471
GRCz11 10 17543905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCCCAGCTGAAGGTGGACAAGCGGTTTGTGGGCATGTTGAACATGT[T/A]ACGCCACTGCCAGCGTCTGAAGGAGGTCCGAGGCGGTGGTCTTACACGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link