zgc:162303

Ensembl ID:
ENSDARG00000039352
ZFIN ID:
ZDB-GENE-070424-88
Description:
KIAA1274 [Source:RefSeq peptide;Acc:NP_001082854]
Human Orthologue:
KIAA1274
Human Description:
KIAA1274 [Source:HGNC Symbol;Acc:23530]
Mouse Orthologue:
X99384
Mouse Description:
cDNA sequence X99384 Gene [Source:MGI Symbol;Acc:MGI:1351623]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18457 Nonsense Available for shipment Available now
sa35514 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8380 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1051 Nonsense F2 line generated During 2018
sa44788 Nonsense Mutation detected in F1 DNA During 2018
sa16796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057508 Nonsense 330 863 8 20
ENSDART00000137114 Nonsense 350 883 8 20
ENSDART00000138326   None 27 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30403875)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30049823
GRCz11 13 30180273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYGCACCAATCTTGGCTTAATCCTGGGAGCCTTAGTCTTCCATCACCTG[C/T]AGGGGGCATCAAAGAGYCCCAGGTACCAATACTACWTTGTTACTGTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057508 Essential Splice Site 337 863 8 20
ENSDART00000137114 Essential Splice Site 357 883 8 20
ENSDART00000138326   None 27 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30403898)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30049846
GRCz11 13 30180296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGAGCCTTAGTCTTCCATCACCTGCAGGGGGCATCAAAGAGCCCCAG[G/A]TACCAATACTACATTGTTACTGTTTACCTTCTGAAAGTAAAGCACTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057508 Essential Splice Site 519 863 14 20
ENSDART00000137114 Essential Splice Site 539 883 14 20
ENSDART00000138326   None 27 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30407844)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30053792
GRCz11 13 30184242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTAMAGTCTAATAATAACTAATCAAAGCTTGTTTGTGGCCGTTTCA[G/T]GCTTTGGCTGTTGTGATGTCCTACCTGACAGACACAAGGCGAGGGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1051
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057508 Nonsense 565 863 14 20
ENSDART00000137114 Nonsense 585 883 14 20
ENSDART00000138326   None 27 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30407983)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30053931
GRCz11 13 30184381
KASP Assay ID:
554-0954.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGCAAATGGACAGATGTTCACACCGCGAGAGCCAGGCTGTCTGGAA[C/T]AGCCTATTCCAGTCTGTGTTCAACATCCACAGCAGCTCCAGGTGCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057508 Nonsense 621 863 15 20
ENSDART00000137114 Nonsense 641 883 15 20
ENSDART00000138326   None 27 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30410450)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30056398
GRCz11 13 30186848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAGGATGTTCAAGAGTTGTCACACCATCCAGGAGCTCTTTGTCCAC[C/T]AGAAGAGCATTCATCCAGGCCTTAGTTACCAGCGGATTCCTCTGTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057508 Nonsense 675 863 16 20
ENSDART00000137114 Nonsense 695 883 16 20
ENSDART00000138326   None 27 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30410681)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30056629
GRCz11 13 30187079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGACCCCGGCTGCGCTTTCATCTTCAACTGTCACGATGGGAAAGAC[C/T]GAACTACTGCAGCCATGGTTATTGGCACTCTCACCCTGTGGCACAYTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link