tctex1d1

Ensembl ID:
ENSDARG00000039344
ZFIN ID:
ZDB-GENE-040912-49
Description:
Tctex1 domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q66IC8]
Human Orthologue:
TCTEX1D1
Human Description:
Tctex1 domain containing 1 [Source:HGNC Symbol;Acc:26882]
Mouse Orthologue:
Tctex1d1
Mouse Description:
Tctex1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914594]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32862 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057502 Essential Splice Site 64 173 3 5

The following transcripts of ENSDARG00000039344 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 14304979)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14603023
GRCz11 2 14271613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGATATCCAACGGCCTACAGTACAGATGGAGAACACCTATCGCATCA[G/T]TGAGTCTCTTTTCTTTATGTTTTCTTTATGTCTCTTTGTTTCCTCGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link