zgc:66419

Ensembl ID:
ENSDARG00000039309
ZFIN ID:
ZDB-GENE-040426-1636
Description:
hypothetical protein LOC394086 [Source:RefSeq peptide;Acc:NP_957405]
Human Orthologue:
HOOK2
Human Description:
hook homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:19885]
Mouse Orthologue:
Hook2
Mouse Description:
hook homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2181664]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45132 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39997 Nonsense Mutation detected in F1 DNA During 2018
sa33094 Essential Splice Site Available for shipment Available now
sa39998 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057434 Essential Splice Site 15 268 1 10
Genomic Location (Zv9):
Chromosome 3 (position 8299904)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7877320
GRCz11 3 7763160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATGAGCCTGAATAAACATCAGCTGAGCGACTCTTTATTTATCTGGG[T/G]AAGATATAAACCCATCCCGCTGACAAGCAGCTATATTTAGAGGGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057434 Nonsense 64 268 3 10
Genomic Location (Zv9):
Chromosome 3 (position 8312099)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7889515
GRCz11 3 7775355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATGAGACTTGGCTCAGCAGGATAAAAGAGGATGGAGGCACAAACTG[G/A]AGGCTGAAGGTATTTTACTGGAGTTGTAGTCTTTCTGTACTGTATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057434 Essential Splice Site 67 268 3 10
Genomic Location (Zv9):
Chromosome 3 (position 8312110)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7889526
GRCz11 3 7775366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCTCAGCAGGATAAAAGAGGATGGAGGCACAAACTGGAGGCTGAAGG[T/A]ATTTTACTGGAGTTGTAGTCTTTCTGTACTGTATACTGTATGTTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057434 Nonsense 178 268 8 10
Genomic Location (Zv9):
Chromosome 3 (position 8336356)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7913772
GRCz11 3 7799612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACACTCTCTGACAGTACTGTGTGTGTTACAGAAGCTCATTTCTGAA[C/T]GAGACACACTGAGAGAGACGACTGAAGAGCTGAGGTGTGCTCAAGTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link