six1a

Ensembl ID:
ENSDARG00000039304
ZFIN ID:
ZDB-GENE-040718-155
Description:
sine oculis homeobox homolog 1a [Source:RefSeq peptide;Acc:NP_001009904]
Human Orthologue:
SIX1
Human Description:
SIX homeobox 1 [Source:HGNC Symbol;Acc:10887]
Mouse Orthologue:
Six1
Mouse Description:
sine oculis-related homeobox 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057432 Nonsense 35 283 1 2
Genomic Location (Zv9):
Chromosome 13 (position 31845457)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31491405
GRCz11 13 31621855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGCTGCAGCAGGGTGGGAACCTGGAGAGGCTCGGACGGTTCCTTTG[G/A]TCCYTGCCAGCCTGCGACCACCTCCACAAGAAYGAATCCGTGCTCAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link