vti1b

Ensembl ID:
ENSDARG00000039270
ZFIN ID:
ZDB-GENE-040426-1148
Description:
vesicle transport through interaction with t-SNAREs homolog 1B [Source:RefSeq peptide;Acc:NP_957330
Human Orthologue:
VTI1B
Human Description:
vesicle transport through interaction with t-SNAREs homolog 1B (yeast) [Source:HGNC Symbol;Acc:17793
Mouse Orthologue:
Vti1b
Mouse Description:
vesicle transport through interaction with t-SNAREs 1B homolog Gene [Source:MGI Symbol;Acc:MGI:18556

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38954 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057379 Nonsense 122 225 4 6
ENSDART00000135955 Nonsense 58 161 3 5
Genomic Location (Zv9):
Chromosome 13 (position 33266259)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32912207
GRCz11 13 33042657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAATTACTAATTTCTGTGTTTGTTTTTGCAGACTCATCTTCAGTCA[C/T]AGCGTGCTTTGCTAATCCAGGGGACAGAGTCTCTAAATAATGCGTCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link