zgc:171579

Ensembl ID:
ENSDARG00000039234
ZFIN ID:
ZDB-GENE-080204-32
Description:
hypothetical protein LOC557116 [Source:RefSeq peptide;Acc:NP_001107053]
Human Orthologues:
GPR132, GPR4, GPR65, GPR68
Human Descriptions:
G protein-coupled receptor 132 [Source:HGNC Symbol;Acc:17482]
G protein-coupled receptor 4 [Source:HGNC Symbol;Acc:4497]
G protein-coupled receptor 65 [Source:HGNC Symbol;Acc:4517]
G protein-coupled receptor 68 [Source:HGNC Symbol;Acc:4519]
Mouse Orthologues:
Gpr132, Gpr4, Gpr65, Gpr68
Mouse Descriptions:
G protein-coupled receptor 132 Gene [Source:MGI Symbol;Acc:MGI:1890220]
G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2441992]
G protein-coupled receptor 68 Gene [Source:MGI Symbol;Acc:MGI:2441763]
G-protein coupled receptor 65 Gene [Source:MGI Symbol;Acc:MGI:108031]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42269 Nonsense Mutation detected in F1 DNA During 2018
sa35568 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057320 Nonsense 85 335 2 2
Genomic Location (Zv9):
Chromosome 13 (position 38618254)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38095066
GRCz11 13 38220956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAACCTGCTGATCTCAGACCTAATTCAACTCCTGACTTTGCCTTTATG[G/A]ATGGATTATTACGCCAATGGACACAACTGGCGATTTGGGCCCCGTAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057320 Nonsense 282 335 2 2
Genomic Location (Zv9):
Chromosome 13 (position 38618843)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38095655
GRCz11 13 38221545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAAGTGCGTTTGGGAGAAAGCGGTGTTTGTGCCCTATCAGTTAGGA[C/T]GAGGCCTTCTGAGCCTTAACAGCTTGCTGGATCCTGTGTTTTACATCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link