vps13a

Ensembl ID:
ENSDARG00000039225
ZFIN ID:
ZDB-GENE-030926-1
Description:
vacuolar protein sorting 13 homolog A [Source:RefSeq peptide;Acc:NP_001112365]
Human Orthologue:
VPS13A
Human Description:
vacuolar protein sorting 13 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:1908]
Mouse Orthologue:
Vps13a
Mouse Description:
vacuolar protein sorting 13A (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444304]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41308 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34514 Essential Splice Site Mutation detected in F1 DNA During 2018
sa771 Nonsense F2 line generated During 2018
sa21398 Nonsense Available for shipment Available now
sa41307 Nonsense Mutation detected in F1 DNA During 2018
sa8612 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8672 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16081 Essential Splice Site Available for shipment Available now
sa34513 Nonsense Mutation detected in F1 DNA During 2018
sa731 Essential Splice Site Available for shipment Available now
sa21397 Nonsense Available for shipment Available now
sa8566 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 294 3217 11 71
ENSDART00000110359 Essential Splice Site 294 3236 11 72
ENSDART00000111204 Essential Splice Site 294 3194 11 73
Genomic Location (Zv9):
Chromosome 8 (position 54359371)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52094730
GRCz11 8 52081259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGGTGGTCAACCTTCCTGAAGTGGCCGTGGAGCTCAGCCGACCACAG[G/A]TCTGGACTTGTGCAAAAATATGCACTTTTTCCTCACAAAAGGTGTACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 330 3217 12 71
ENSDART00000110359 Essential Splice Site 330 3236 12 72
ENSDART00000111204 Essential Splice Site 330 3194 12 73
Genomic Location (Zv9):
Chromosome 8 (position 54359169)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52094528
GRCz11 8 52081057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAAGTATCGGCCATATGTGGTGGTTCACACTAACGCTCGTCAGTGG[T/G]GAGTGCTTTTGGAGTTCGTGGTCTTGTGTGTTTTGTAAAGCTGCATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa771
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Nonsense 429 3217 15 71
ENSDART00000110359 Nonsense 429 3236 15 72
ENSDART00000111204 Nonsense 429 3194 15 73
Genomic Location (Zv9):
Chromosome 8 (position 54355473)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52090832
GRCz11 8 52077361
KASP Assay ID:
554-0676.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGCTCAGGATTTACCGGCCCGGGGTGAAGGTGGAGGAGGAACAGTCA[C/T]AGGGCTGGTTTGGCTGGATGTGGAACTGGTCTGGAGAAGCCAGTGCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Nonsense 551 3217 18 71
ENSDART00000110359 Nonsense 551 3236 18 72
ENSDART00000111204 Nonsense 551 3194 18 73
Genomic Location (Zv9):
Chromosome 8 (position 54349177)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52084536
GRCz11 8 52071065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGCTCAGCTGTCGTCGTTTGAAGTGTCCGGTCTCCCGCGGGAAAAGT[C/A]GGCCCCGATCCTGCTTTCTCCACGTCATGTGGACGGCATGAAGGATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Nonsense 598 3217 18 71
ENSDART00000110359 Nonsense 598 3236 18 72
ENSDART00000111204 Nonsense 598 3194 18 73
Genomic Location (Zv9):
Chromosome 8 (position 54349035)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52084394
GRCz11 8 52070923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCTGACCAGAGACTGCGCATCGAGTCCCAGCCGCTGGAGATCATCTA[T/A]GATGCAGTGAGGCTCTGTGACAGTTAATATATTCTTCATATATTCCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 980 3217 27 71
ENSDART00000110359 Essential Splice Site 980 3236 27 72
ENSDART00000111204 Essential Splice Site 980 3194 27 73
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 980 3217 27 71
ENSDART00000110359 Essential Splice Site 980 3236 27 72
ENSDART00000111204 Essential Splice Site 980 3194 27 73
Genomic Location (Zv9):
Chromosome 8 (position 54336862)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52072221
GRCz11 8 52058750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCTGGACAACACRGAGGAGGATCTGCTCACTCTGGAGKAWGTCAAGG[T/C]AAGAGGAGAGTNNNNNGTCAGCTGTTTAATCAAATTAGCTTTAAAATATYCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 980 3217 27 71
ENSDART00000110359 Essential Splice Site 980 3236 27 72
ENSDART00000111204 Essential Splice Site 980 3194 27 73
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 980 3217 27 71
ENSDART00000110359 Essential Splice Site 980 3236 27 72
ENSDART00000111204 Essential Splice Site 980 3194 27 73
Genomic Location (Zv9):
Chromosome 8 (position 54336862)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52072221
GRCz11 8 52058750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCTGGACAACACRGAGGAGGATCTGCTCACTCTGGAGKAWGTCAAGG[T/C]AAGAGGAGAGTNNNNNGTCAGCTGTTTAATCAAATTAGCTTTAAAATATYCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 1142 3217 31 71
ENSDART00000110359 Essential Splice Site 1142 3236 31 72
ENSDART00000111204 Essential Splice Site 1131 3194 31 73
Genomic Location (Zv9):
Chromosome 8 (position 54333164)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52068523
GRCz11 8 52055052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGAACATCATCATTCTGGATTGTGACAAAGAGGYACTTTATAAAAAG[G/A]TAGAAAATGCTATTTAGYATMTTAAATATAAATTAATCAACTGGTACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Nonsense 1251 3217 33 71
ENSDART00000110359 Nonsense 1251 3236 33 72
ENSDART00000111204 Nonsense 1240 3194 33 73
Genomic Location (Zv9):
Chromosome 8 (position 54329298)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52064657
GRCz11 8 52051186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGATCTCCCTGGACGTCGACATCAAAGCTCCTGTTGTCTTCCTCCCA[C/T]AATCCTCAGTTTCCCACAACGTCATTGTGGCAGATCTGGGTTTAGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923   1576 3217 39 71
ENSDART00000110359   1576 3236 39 72
ENSDART00000111204 Essential Splice Site 1562 3194 41 73
Genomic Location (Zv9):
Chromosome 8 (position 54321231)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52056590
GRCz11 8 52043119
KASP Assay ID:
554-0638.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARTAGCTGTATGATTTGTGTTATTCCTCTTCTAGCGGCTCCTGCTCCACC[A/T]GTGGTTGCTAAAACCGAGATGAATGTGGTGGTGAAGAACCCAGAGATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Nonsense 2268 3217 47 71
ENSDART00000110359 Nonsense 2260 3236 47 72
ENSDART00000111204 Nonsense 2246 3194 49 73
Genomic Location (Zv9):
Chromosome 8 (position 54307985)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52043344
GRCz11 8 52029873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACACTCGCCGTACTGGATGGTGAATAAAACAAGCCGACTGCTGCAGTA[C/A]AAGGCGGATGATATTCATCGCAAACACCCCAAGGATTACGACATGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009383   None 318 None 11
ENSDART00000108923 Essential Splice Site 2383 3217 49 71
ENSDART00000110359 Essential Splice Site 2375 3236 49 72
ENSDART00000111204   None 3194 None 73
Genomic Location (Zv9):
Chromosome 8 (position 54304780)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52040139
GRCz11 8 52026668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTGTGAGGAGGGKCAGGAGAACTGGACAGAAGCCCGACCCGGACAG[G/A]TCTGGATATACAGCTCGCTTTAWTAAATAAATACTTTAAATCTTTGAWTY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link