zgc:77439

Ensembl ID:
ENSDARG00000039211
ZFIN ID:
ZDB-GENE-031010-24
Description:
dimethylanaline monooxygenase-like [Source:RefSeq peptide;Acc:NP_001184218]
Human Orthologues:
FMO1, FMO2, FMO3, FMO4, FMO5, FMO6P
Human Descriptions:
flavin containing monooxygenase 1 [Source:HGNC Symbol;Acc:3769]
flavin containing monooxygenase 2 (non-functional) [Source:HGNC Symbol;Acc:3770]
flavin containing monooxygenase 3 [Source:HGNC Symbol;Acc:3771]
flavin containing monooxygenase 4 [Source:HGNC Symbol;Acc:3772]
flavin containing monooxygenase 5 [Source:HGNC Symbol;Acc:3773]
flavin containing monooxygenase 6 pseudogene [Source:HGNC Symbol;Acc:24024]
Mouse Orthologues:
Fmo1, Fmo2, Fmo3, Fmo4, Fmo5, Fmo9, Gm4846, Gm4847
Mouse Descriptions:
flavin containing monooxygenase 1 Gene [Source:MGI Symbol;Acc:MGI:1310002]
flavin containing monooxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:1916776]
flavin containing monooxygenase 3 Gene [Source:MGI Symbol;Acc:MGI:1100496]
flavin containing monooxygenase 4 Gene [Source:MGI Symbol;Acc:MGI:2429497]
flavin containing monooxygenase 5 Gene [Source:MGI Symbol;Acc:MGI:1310004]
flavin containing monooxygenase 9 Gene [Source:MGI Symbol;Acc:MGI:3606068]
predicted gene 4846 Gene [Source:MGI Symbol;Acc:MGI:3643319]
predicted gene 4847 Gene [Source:MGI Symbol;Acc:MGI:3643320]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20942 Nonsense Available for shipment Available now
sa20941 Nonsense Available for shipment Available now
sa40892 Nonsense Mutation detected in F1 DNA During 2018
sa10179 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057288 Nonsense 38 449 2 8
ENSDART00000140817 Nonsense 42 229 2 6
ENSDART00000146440 Nonsense 38 225 2 6
ENSDART00000146935 Nonsense 38 225 2 6

The following transcripts of ENSDARG00000039211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27432096)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26035035
GRCz11 7 26306228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGTCACCTGCTCTCCCGCCCGGACACCTTCGCGGCGCCGGTGGTCTA[C/A]GAGCTCACCAAGAACATCGGAGGAACCTGGGTCTATGAGGAAAAAGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057288 Nonsense 148 449 4 8
ENSDART00000140817 Nonsense 152 229 4 6
ENSDART00000146440 Nonsense 148 225 4 6
ENSDART00000146935 Nonsense 148 225 4 6

The following transcripts of ENSDARG00000039211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27430598)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26033537
GRCz11 7 26304730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGATGGGTGGAATGGTTTGGCATGGAACGTCACCTCAAATAATGGCT[T/A]AGACCACAGCAAATCCACTACAGAGCGCTTTGATGCTGTCATGGTGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057288 Nonsense 169 449 5 8
ENSDART00000140817 Nonsense 173 229 5 6
ENSDART00000146440 Nonsense 169 225 5 6
ENSDART00000146935 Nonsense 169 225 5 6

The following transcripts of ENSDARG00000039211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27430291)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26033230
GRCz11 7 26304423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTGAGTTTTACAAATGACTTTTGTGTGTTTATTGCAGACATTTCTA[T/G]GACCCTTACATCCCTGCAATACCTGGACTGGAGAAATTCAAAGGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057288 Nonsense 298 449 7 8
ENSDART00000140817   None 229 None 6
ENSDART00000146440   None 225 None 6
ENSDART00000146935   None 225 None 6

The following transcripts of ENSDARG00000039211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27426637)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26029576
GRCz11 7 26300769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTCCTAGATGAGAAAGTGGGTGTAAAAGTGCAGGAGCACCTTGTCTG[G/A]CCCCTCTATAAGTTCCTAATTCCTCCAGCCTACCCGTCCCTCTTTATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lentiform nucleus volume : Genome-wide association identifies genetic variants associated with lentiform nucleus volume in N = 1345 young and elderly subjects. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link