trim9

Ensembl ID:
ENSDARG00000039123
ZFIN ID:
ZDB-GENE-030131-8043
Description:
tripartite motif-containing protein 9 [Source:RefSeq peptide;Acc:NP_991126]
Human Orthologue:
TRIM9
Human Description:
tripartite motif-containing 9 [Source:HGNC Symbol;Acc:16288]
Mouse Orthologue:
Trim9
Mouse Description:
tripartite motif-containing 9 Gene [Source:MGI Symbol;Acc:MGI:2137354]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35559 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048739 Nonsense 486 699 6 10
Genomic Location (Zv9):
Chromosome 13 (position 37287343)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36759645
GRCz11 13 36885477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCACCATCGCTGTGGACGGGTATATTCTAGAGCTGGATGATGGCACT[G/T]GAGGCCAGTTCAGAGTGAGTCACATATACTGTACATACAGTGAAGCTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link