zgc:123010

Ensembl ID:
ENSDARG00000039082
ZFIN ID:
ZDB-GENE-051120-15
Description:
tetratricopeptide repeat protein 31 [Source:RefSeq peptide;Acc:NP_001139026]
Human Orthologue:
TTC31
Human Description:
tetratricopeptide repeat domain 31 [Source:HGNC Symbol;Acc:25759]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42276 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17718 Essential Splice Site Available for shipment Available now
sa9064 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057073 Essential Splice Site 328 501 10 16
ENSDART00000059443   None 342 None 12
ENSDART00000140875 Essential Splice Site 301 474 10 16
Genomic Location (Zv9):
Chromosome 13 (position 40606985)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40133431
GRCz11 13 40259321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAAGCTGTCAATGACCTCTTGTACTGTAAAGTGCAACAACTTACGG[T/G]AAAGATAGTGCTGTCTTTGGCTCTTTCTGTTCAAATAATTTAGTGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057073 Essential Splice Site 355 501 11 16
ENSDART00000059443   None 342 None 12
ENSDART00000140875 Essential Splice Site 328 474 11 16
Genomic Location (Zv9):
Chromosome 13 (position 40603892)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40130338
GRCz11 13 40256228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTGCTGGAAAAATATAATACAGTGCAGGCCGTTGTTGCAGCCAAGGG[T/C]AAGAGTTYATTTMTTTTCTCGATTGAAGYRAACCACTTGAGGGTGCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057073 Nonsense 486 501 16 16
ENSDART00000059443   None 342 None 12
ENSDART00000140875 Nonsense 459 474 16 16
Genomic Location (Zv9):
Chromosome 13 (position 40598025)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40124471
GRCz11 13 40250361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGTGTTACTTCTGGAGGACCACCGGCTGTCATTTTGGAGATAGGTG[T/A]CGCTATAAGCACATTCCMGATCACAGAGGCAAAGACTGGCAACCTTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link