zgc:64090

Ensembl ID:
ENSDARG00000039069
ZFIN ID:
ZDB-GENE-040426-1365
Description:
UPF0492 protein C20orf94 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7T2B3]
Human Orthologue:
C20orf94
Human Description:
chromosome 20 open reading frame 94 [Source:HGNC Symbol;Acc:16225]
Mouse Orthologue:
2210009G21Rik
Mouse Description:
RIKEN cDNA 2210009G21 gene Gene [Source:MGI Symbol;Acc:MGI:1921493]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19065 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42248 Nonsense Mutation detected in F1 DNA During 2018
sa698 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Essential Splice Site 137 499 6 12
ENSDART00000144109 Essential Splice Site 128 490 4 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35640459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35293035
GRCz11 13 35418867
KASP Assay ID:
2260-6713.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCAGAGAATTCCGCACTTCCCAATGGAAATCTGAACCTGGATGTGG[T/A]AAGAACTGCTTATGTTATAAAATAATGTTTATAATCAGTGTCGGAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Nonsense 193 499 8 12
ENSDART00000144109 Nonsense 184 490 6 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35616788)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35269364
GRCz11 13 35395196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCCCCACGATCGCAAGATAATCAAGAGTCCAAAACAGGACAATTT[C/T]AAGCAGACAATGCAGAGAAGGGCTCTAGATCTGTCCTTCAGAGGATGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Nonsense 294 499 11 12
ENSDART00000144109 Nonsense 285 490 9 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35614807)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35267383
GRCz11 13 35393215
KASP Assay ID:
554-0606.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTTCTATTTTTTTTNCAGAGCCAAAGAGACAAACACCCAACCTCCA[C/T]AATCCCAAGATGATCAAGAATTCAAATCAGGCCAATTTCCAGCAGGCGAA
Associated Phenotype:
Data not yet available

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link