
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:64090
- Ensembl ID:
- ENSDARG00000039069
- ZFIN ID:
- ZDB-GENE-040426-1365
- Description:
- UPF0492 protein C20orf94 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7T2B3]
- Human Orthologue:
- C20orf94
- Human Description:
- chromosome 20 open reading frame 94 [Source:HGNC Symbol;Acc:16225]
- Mouse Orthologue:
- 2210009G21Rik
- Mouse Description:
- RIKEN cDNA 2210009G21 gene Gene [Source:MGI Symbol;Acc:MGI:1921493]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19065 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42248 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa698 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19065
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057052 | Essential Splice Site | 137 | 499 | 6 | 12 |
ENSDART00000144109 | Essential Splice Site | 128 | 490 | 4 | 10 |
The following transcripts of ENSDARG00000039069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 35640459)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 35293035 GRCz11 13 35418867 - KASP Assay ID:
- 2260-6713.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTCCAGAGAATTCCGCACTTCCCAATGGAAATCTGAACCTGGATGTGG[T/A]AAGAACTGCTTATGTTATAAAATAATGTTTATAATCAGTGTCGGAGAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42248
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057052 | Nonsense | 193 | 499 | 8 | 12 |
ENSDART00000144109 | Nonsense | 184 | 490 | 6 | 10 |
The following transcripts of ENSDARG00000039069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 35616788)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 35269364 GRCz11 13 35395196 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAGCCCCCACGATCGCAAGATAATCAAGAGTCCAAAACAGGACAATTT[C/T]AAGCAGACAATGCAGAGAAGGGCTCTAGATCTGTCCTTCAGAGGATGTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa698
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000057052 | Nonsense | 294 | 499 | 11 | 12 |
ENSDART00000144109 | Nonsense | 285 | 490 | 9 | 10 |
The following transcripts of ENSDARG00000039069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 35614807)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 35267383 GRCz11 13 35393215 - KASP Assay ID:
- 554-0606.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATTTTCTATTTTTTTTNCAGAGCCAAAGAGACAAACACCCAACCTCCA[C/T]AATCCCAAGATGATCAAGAATTCAAATCAGGCCAATTTCCAGCAGGCGAA
- Associated Phenotype:
- Data not yet available
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: