zgc:114078

Ensembl ID:
ENSDARG00000038995
ZFIN ID:
ZDB-GENE-050913-80
Description:
translin-associated protein X [Source:RefSeq peptide;Acc:NP_001025275]
Human Orthologue:
TSNAX
Human Description:
translin-associated factor X [Source:HGNC Symbol;Acc:12380]
Mouse Orthologues:
AC168060.1, Tsnax
Mouse Descriptions:
translin-associated factor X Gene [Source:MGI Symbol;Acc:MGI:1855672]
Translin-associated protein X [Source:UniProtKB/Swiss-Prot;Acc:Q9QZE7]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35595 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056926 Nonsense 239 281 6 6
Genomic Location (Zv9):
Chromosome 13 (position 50132728)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48863766
GRCz11 13 49154444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCAACACGGGGCCCTATGAAGTGTCCAAGAAGCTGCACACGCTCCGC[C/T]AGAGCCTGGGGAAGGTGGAGGACGCCTGCTACACCCTGCGCGTCCGCGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link