
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nsfb
- Ensembl ID:
- ENSDARG00000038991
- ZFIN ID:
- ZDB-GENE-050808-1
- Description:
- N-ethylmaleimide-sensitive factor b [Source:RefSeq peptide;Acc:NP_001019625]
- Human Orthologue:
- NSF
- Human Description:
- N-ethylmaleimide-sensitive factor [Source:HGNC Symbol;Acc:8016]
- Mouse Orthologue:
- Nsf
- Mouse Description:
- N-ethylmaleimide sensitive fusion protein Gene [Source:MGI Symbol;Acc:MGI:104560]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22087 | Nonsense | Available for shipment | Available now |
sa10323 | Nonsense | Available for shipment | Available now |
sa42023 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42022 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22087
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056919 | Nonsense | 247 | 747 | 8 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23701619)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22224781 GRCz11 12 22346000 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTCCGTCGGGCTTTTGCTTCACGAGTCTTTCCTCCAGACATAGTAGAA[C/T]AAATGGGTGAGTCTTTGATTTTGACTGGCTGTATCACTTTAAAAACCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10323
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056919 | Nonsense | 294 | 747 | 9 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23695181)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22218343 GRCz11 12 22339562 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACGCCAGAGAGCCAAAAGTGGTCAAMGGGCCAGAGATTYTGAACAAATA[C/A]GTGGGAGAATCGGAGGCCAACATCAGAAAGCTATTCGCTGATGCTGAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42023
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056919 | Essential Splice Site | 315 | 747 | 9 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23695116)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22218278 GRCz11 12 22339497 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCCAACATCAGAAAGCTATTCGCTGATGCTGAGGAGGAACAGAAGAGGG[T/C]ACGAAACCAGAGATGGCATTTTGTGCAAATTATTCAACACATTGCACGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42022
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056919 | Essential Splice Site | 542 | 747 | 14 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23688378)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22211540 GRCz11 12 22332759 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGACCAAGAACAGTGAACGCACACCCCTAGTTACTGTTCTATTAGAGG[G/A]CAAGTCTTATACAAACAAACACAAATACAGTGTTAGCTAACTGAAACTAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Parkinson's disease: Genome-wide association study identifies candidate genes for Parkinson's disease in an Ashkenazi Jewish population. (View Study)
- Parkinson's disease: Genome-wide association study reveals genetic risk underlying Parkinson's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: