si:dkey-31m5.5

Ensembl ID:
ENSDARG00000038987
ZFIN ID:
ZDB-GENE-070912-517

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19806 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102102 Essential Splice Site 211 446 5 10
ENSDART00000146745   None 214 None 3
Genomic Location (Zv9):
Chromosome 2 (position 33444425)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33743332
GRCz11 2 33726550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTTTGGGACCGTCTATGCAGCGACTCGTTTGGATGATGGACTTCAG[G/A]TATGAATCTGAATTGCAATAATAATCTAGCCATTCATTTTGTCCTATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link