zgc:110680

Ensembl ID:
ENSDARG00000038980
ZFIN ID:
ZDB-GENE-050522-497
Description:
thioredoxin domain-containing protein 12 [Source:RefSeq peptide;Acc:NP_001018660]
Human Orthologue:
TXNDC12
Human Description:
thioredoxin domain containing 12 (endoplasmic reticulum) [Source:HGNC Symbol;Acc:24626]
Mouse Orthologue:
Txndc12
Mouse Description:
thioredoxin domain containing 12 (endoplasmic reticulum) Gene [Source:MGI Symbol;Acc:MGI:1913323]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1870 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056899 Essential Splice Site 49 102 2 4
Genomic Location (Zv9):
Chromosome 2 (position 9361767)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9802799
GRCz11 2 9600804
KASP Assay ID:
554-1861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCCTTCAGTCCAGATGGCGGTTACATTCCCAGAATTCTCTTCCTTGG[T/C]AATTCAAAAACAAATCAGCCAAGCAAATTTGCTAATTTAACACAAWYTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link