si:dkey-24c2.9

Ensembl ID:
ENSDARG00000038979
ZFIN ID:
ZDB-GENE-070912-476
Description:
EGFR-coamplified and overexpressed protein [Source:RefSeq peptide;Acc:NP_001108544]
Human Orthologue:
VOPP1
Human Description:
vesicular, overexpressed in cancer, prosurvival protein 1 [Source:HGNC Symbol;Acc:34518]
Mouse Orthologue:
Vopp1
Mouse Description:
vesicular, overexpressed in cancer, prosurvival protein 1 Gene [Source:MGI Symbol;Acc:MGI:2141658]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32916 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099581 Nonsense 59 159 3 5
ENSDART00000147543 Nonsense 62 162 3 5
Genomic Location (Zv9):
Chromosome 2 (position 24029171)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24179324
GRCz11 2 23834975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGCACAGAATGCTGCGTTCGAGCTCTTGCTGTTCAAAGAATATGGTA[T/A]TTCTGGTGGGTCACTTGCCTCAAAGTTCATTTTATTTTTGGTTTCCTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link